Science & Platform

Time-resolved transcriptomic drug discovery

QUANTRO defines a new state of the art in time resolved transcriptomic drug discovery, using nascent mRNA metabolic labelling to directly measure drug-induced changes in transcriptional dynamics at any point in time.

The problem

Transcription factors are challenging to drug

Transcription factors sit at the centre of disease biology, yet their structural complexity and the lack of assays that directly measure their function have kept them difficult to drug.

Undruggable

Target complexity

Transcription factors and their associated proteins defy rational drug design because they are intrinsically disordered and function in complex, multi-protein assemblies.

Invisible

Lack of assays

Current methods cannot precisely measure changes in transcription, leaving the function of transcription-factor-targeting drugs invisible.

A transcription factor bound to DNA alongside a cofactor and RNA polymerase II, with three intervention points marked: a molecular glue degrader, a protein–protein interaction, and a DNA-binding inhibitor.
© biolution GmbH

Why existing methods fall short

Changes in transcription occur in minutes

Drug-induced changes in transcriptional dynamics cannot be determined with conventional RNA-seq-based methods.

The problem with RNA-seq

  • SuperficialRNA-seq measures mRNA abundance, a steady-state snapshot, not active transcription.
  • Too slowWith a median mRNA half-life of around eight hours, only late changes become visible.
  • UnspecificBy then, direct and indirect effects on transcription can no longer be distinguished.

To overcome the limits of conventional RNA-seq and identify transcription-factor-targeting drugs, QUANTRO developed a scalable, time-resolved transcriptional assay.

QUANTRO core technology

SLAMseq® metabolic labelling makes transcriptional dynamics measurable

SLAMseq® allows measuring the exact ratio of old to new mRNA, enabling precise, time-resolved analysis of drug-induced changes in transcriptional dynamics.

How SLAMseq® works

01

Cell culture

Untreated cells
SSSS
4sU mRNA labelling

Newly synthesised mRNA is labelled with 4sU during a defined one-hour window in living cells.

02

Cell-free lysate

S*S*S*S*S*S*
4sU alkylation
G*G*G*
Reverse transcription

After cell lysis, the labelled RNA is chemically alkylated and reverse-transcribed into single-stranded cDNA.

03

Sequencing

agtgaatccagcagtgatgatgatgaagtgaatccagcagtgatgatgatgaagtgaatccagcagtgatgatgatgaagcgaatccagcagtgacgatgatgaagtgaacccagcagtgatgacgatgaagcgaatccagcagcgatgatgacga
T→C conversion in 3′-mRNA-seq

Old and new mRNA are now visible: T-to-C conversions in the sequencing data distinguish newly synthesised mRNA from pre-existing mRNA.

Read the foundational publications →

Platform workflow

From target biology to validated compounds

QUANTRO combines target degradation with time-resolved transcriptomics to create a searchable, target-specific transcriptional fingerprint for compound discovery.

01

Create the reference

Degron engineering & target degradation

Engineer the target for rapid, controlled degradation and measure the immediate transcriptional response.

02

Define fingerprint

Time-resolved transcriptomics

Identify the primary-response genes that define the target-specific transcriptional fingerprint.

03

Screen

Assay development, screen

Develop the assay and screen compound libraries for molecules that reproduce the fingerprint.

04

Hit validation

Validate and characterise hits

Validate selected hits across the full transcriptome and characterise their selectivity and mechanism.

Assay toolbox

QUANTRO’s transcriptomic HTS toolbox

Different assays for different purposes, balancing information depth and throughput across the discovery process.

Three assay formats compared. QUANTROsens: pre-screen, 3 genes · readout, Up to 150,000 compounds per month, HTS pre-screen, preliminary selectivity and dual target + control.. QUANTROseq®: multiplex, 100 genes · readout, Up to 10,000 compounds per month, Multi-target HTS and direct selectivity data.. QUANTROslam®: full depth, 20,000 genes · readout, Up to 1,000 profiles per month, Full-transcriptome profile, target-gene identification, hit-validation screen and full selectivity data..

Pre-screen

QUANTROsens

3 genes · readout
Throughput

Up to 150,000 compounds per month

Role

HTS pre-screen, preliminary selectivity and dual target + control.

Multiplex

QUANTROseq®

100 genes · readout
Throughput

Up to 10,000 compounds per month

Role

Multi-target HTS and direct selectivity data.

Full depth

QUANTROslam®

20,000 genes · readout
Throughput

Up to 1,000 profiles per month

Role

Full-transcriptome profile, target-gene identification, hit-validation screen and full selectivity data.

Function-first transcriptomic drug discovery

QUANTRO takes a function-first approach

Most discovery platforms start from biophysical binding or structure-based design approaches. QUANTRO´s transcriptomic discovery uses target-specific transcriptional responses to select compounds that reproduce the desired functional transcriptional response.

This function-first entry point opens direct access to difficult to drug transcription-factor targets. We successfully implemented compound discovery while remaining agnostic to binding site and mechanism, potentiating the chances to find innovative chemistry modulating these targets´ function.

QUANTRO successfully applies this approach across its proprietary pipeline and partnered drug-discovery programmes.